|
Addgene inc
shcontrol scrambled cgcgaagtctgtactcttg ![]() Shcontrol Scrambled Cgcgaagtctgtactcttg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/shcontrol scrambled cgcgaagtctgtactcttg/product/Addgene inc Average 93 stars, based on 1 article reviews
shcontrol scrambled cgcgaagtctgtactcttg - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
scramble shctr sc 108080 rna particles ![]() Scramble Shctr Sc 108080 Rna Particles, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/scramble shctr sc 108080 rna particles/product/Santa Cruz Biotechnology Average 96 stars, based on 1 article reviews
scramble shctr sc 108080 rna particles - by Bioz Stars,
2026-06
96/100 stars
|
Buy from Supplier |
|
SuperArray Bioscience Corporation
shctrl scrambled sequence ![]() Shctrl Scrambled Sequence, supplied by SuperArray Bioscience Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/shctrl scrambled sequence/product/SuperArray Bioscience Corporation Average 90 stars, based on 1 article reviews
shctrl scrambled sequence - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Addgene inc
shctrl 1 ![]() Shctrl 1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/shctrl 1/product/Addgene inc Average 96 stars, based on 1 article reviews
shctrl 1 - by Bioz Stars,
2026-06
96/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
constitutive promoter ![]() Constitutive Promoter, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/constitutive promoter/product/Santa Cruz Biotechnology Average 93 stars, based on 1 article reviews
constitutive promoter - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
BioVector Inc
non targeting scrambled control (shctrl ![]() Non Targeting Scrambled Control (Shctrl, supplied by BioVector Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/non targeting scrambled control (shctrl/product/BioVector Inc Average 90 stars, based on 1 article reviews
non targeting scrambled control (shctrl - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Addgene inc
plko 1 shctrl puro target sequence 5 cctaaggttaagtcgccctcg 3 ![]() Plko 1 Shctrl Puro Target Sequence 5 Cctaaggttaagtcgccctcg 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plko 1 shctrl puro target sequence 5 cctaaggttaagtcgccctcg 3/product/Addgene inc Average 93 stars, based on 1 article reviews
plko 1 shctrl puro target sequence 5 cctaaggttaagtcgccctcg 3 - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
hairpin rnas shrna sequence sequence shctr ![]() Hairpin Rnas Shrna Sequence Sequence Shctr, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/hairpin rnas shrna sequence sequence shctr/product/Santa Cruz Biotechnology Average 96 stars, based on 1 article reviews
hairpin rnas shrna sequence sequence shctr - by Bioz Stars,
2026-06
96/100 stars
|
Buy from Supplier |
|
OriGene
rat shrna constructs against nr4a1 ![]() Rat Shrna Constructs Against Nr4a1, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rat shrna constructs against nr4a1/product/OriGene Average 90 stars, based on 1 article reviews
rat shrna constructs against nr4a1 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Genechem
aav9 shctrl ![]() Aav9 Shctrl, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/aav9 shctrl/product/Genechem Average 86 stars, based on 1 article reviews
aav9 shctrl - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
|
SLIT2 LTD
slit2 knockdown ![]() Slit2 Knockdown, supplied by SLIT2 LTD, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/slit2 knockdown/product/SLIT2 LTD Average 90 stars, based on 1 article reviews
slit2 knockdown - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Genechem
control shctrl ![]() Control Shctrl, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/control shctrl/product/Genechem Average 86 stars, based on 1 article reviews
control shctrl - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
Image Search Results
Journal: The Journal of Biological Chemistry
Article Title: Subcellular regulation of glucose metabolism through multienzyme glucosome assemblies by EGF–ERK1/2 signaling pathways
doi: 10.1016/j.jbc.2022.101675
Figure Lengend Snippet: High-content imaging analysis of glucosomes from Hs578T cells. A , the percentages (%) of EGF-treated Hs578T cells displaying each size of PFKL-mEGFP assemblies were quantified from at least three independent imaging sessions in the presence of SCH772984 ( gray ), shERK1 ( yellow ), shERK2 ( blue ), or shControl Scrambled ( green ). Note that the previously reported distributions of glucosomes in various sizes in the absence and presence of 30 ng/ml EGF ( purple and red , respectively) are also graphed together for direct comparison. B , a table shows the average percentages (%) of Hs578T cells displaying the given sized glucosomes at each condition along with their SDs (±). Statistical analyses were performed using Tukey’s multiple comparison tests for two-way ANOVA analysis. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.0001. N.S.; not significant. EGF, epidermal growth factor; mEGFP, monomeric enhanced GFP; PFKL, liver-type phosphofructokinase 1.
Article Snippet: Hs578T cells were transfected with shRNAs targeting ERK1/2 (shERK1 and shERK2) and a control shRNA with a scrambled sequence (
Techniques: Imaging
Journal: The Journal of Biological Chemistry
Article Title: Subcellular regulation of glucose metabolism through multienzyme glucosome assemblies by EGF–ERK1/2 signaling pathways
doi: 10.1016/j.jbc.2022.101675
Figure Lengend Snippet: Western blot analysis of ERK1/2 knockdown. Epidermal growth factor-treated Hs578T cells were transfected with shERK1, shERK2, or shControl Scrambled and subsequently selected in the presence of puromycin (1 μg/ml). A , Western blot analysis showed the knockdown of total ERK1/2, but no change was detected for pERK1/2 in the presence of shERK1/2. B and C , expression levels of total ERK1/2 and phosphorylated ERK1/2 (pERK1/2) were normalized based on load controls (β-actin), respectively. The error bars represent the SDs of at least three independent experiments. Statistical analyses were performed using two-sample two-tailed t test. ∗ p < 0.05, ∗∗ p < 0.01. N.S.; not significant. ERK, extracellular signal-regulated kinase.
Article Snippet: Hs578T cells were transfected with shRNAs targeting ERK1/2 (shERK1 and shERK2) and a control shRNA with a scrambled sequence (
Techniques: Western Blot, Transfection, Expressing, Two Tailed Test
Journal: Frontiers in Oncology
Article Title: VRK3 depletion induces cell cycle arrest and metabolic reprogramming of pontine diffuse midline glioma - H3K27 altered cells
doi: 10.3389/fonc.2023.1229312
Figure Lengend Snippet: VRK3 impair chromosome segregation/affect chromatin dynamics in DMG (A) Hierarchical clustering and heatmap of modulated genes after VRK3 KD involved in chromosome segregation (Gene Ontology GO:0044843). (B) Protein modulation of VRK3, ERK and MSK2 96 h after transduction with shCTRL-1 or shVRK3-4. Cyclophilin was used as loading control. (C) Western Blot analysis showing levels of H3S10P in GSC1, GSC2 (H3.3-K27M model) and GSC3, GSC4 (H3.1-K27M) with or without nocodazole treatment. Histone H4 was used as loading control. (D, E) Western Blot analysis showing levels of H3S10P and H3S28P in H3.3-K27M GSC1 and H3.1-K27M GSC4 with or without nocodazole treatment 168h after transduction with shCTRL-1 or shVRK3-4. Histone H4 was used as loading control. (F) Protein modulation of VRK1 and VRK3 168h after transduction in GSC1. Cyclophilin was used as loading control.
Article Snippet: GSCs were transduced at a multiplicity of infection (M.O.I.) of 3 with shVRK3-1, shVRK3-4,
Techniques: Transduction, Western Blot
Journal: Frontiers in Oncology
Article Title: VRK3 depletion induces cell cycle arrest and metabolic reprogramming of pontine diffuse midline glioma - H3K27 altered cells
doi: 10.3389/fonc.2023.1229312
Figure Lengend Snippet: VRK3 inhibition led to DMG-H3K27M altered G1 growth cell arrest (A) Two-dimensional plots (EdU vs. FxCycle Violet stain) of GSC4 cells 96h hours after transduction with shCtrl-1, shCtrl-2, shVRK3-1 and shVRK3-4 and quantification of the different cell-cycle population. At least thirty thousand cells were recorded for each condition, triplicates were performed for each GSC model except duplicates for GSC3 cells. (B) Histogram presenting percentage of the different cell-cycle populations in GSC cells (H3.3-K27M models GSC1, GSC2 in light green, H3.1-K27M models GSC3, GSC4 in dark green) 96h after transduction at M.O.I. 3 with shCTRL-1, shCTRL-2, shVRK3-1 and shVRK3-4. At least thirty thousand cells were recorded for each condition, quadriplicates were performed for each GSC model except duplicates for GSC3 cells. (C) Hierarchical clustering of DEGs in shVRK3 versus shCTRL belonging to cell cycle G1/S phase transition geneset (Gene Ontology GO:0007059). Heatmap shows RNAseq expression level (Z-score on normalized expression matrix) (D) Bar charts presenting modulation of CDK and CDK inhibitors in H3.3 and H3.1-mutated cells after VRK3 KD. Gene modulation is presented as the log2FC of RNAseq data on y-axis and the significance is encoded by color transparency. (E) Western Blot analysis showing levels of P27, P21 and P16 in GSC1 and GSC2 (H3.3-K27M model) and GSC4 (H3.1-K27M) 96h or 168h after transduction with shCtrl-1 or shVRK3-4. Cyclophilin was used as loading control. Densimetric quantification of western blot was processed with Image Lab and P27 protein level was normalized to cyclophilin expression.
Article Snippet: GSCs were transduced at a multiplicity of infection (M.O.I.) of 3 with shVRK3-1, shVRK3-4,
Techniques: Inhibition, Staining, Transduction, Sublimation, Expressing, Western Blot
Journal: Journal of Clinical Laboratory Analysis
Article Title: A long non‐coding RNA OLBC15 promotes triple‐negative breast cancer progression via enhancing ZNF326 degradation
doi: 10.1002/jcla.23304
Figure Lengend Snippet: OLBC15 promotes TNBC in vitro. A, Overexpression efficiency by lentiviral OLBC15 transfection. B, Knockdown efficiency using shRNA targeting OLBC15. ShOLBC15 displayed higher efficiency and was selected as ShOLBC15. C‐D, Effect of OLBC15 on viability of BT‐549 (C) and MDA‐MB‐231 (D) cells transfected with shRNA scrambled control (ShCtrl), ShOLBC15, lentiviral control (OE‐control), or the lentiviral vector carrying OLBC15 (OE‐OLBC15). E, Effect of OLBC15 on migratory capacity of MDA‐MB‐231 (top) and BT‐549 (bottom) cells. F, Quantification of results in (E). **: P < .01
Article Snippet: The short hairpin RNA (shRNA) for OLBC15 (ShOLBC15) together with a
Techniques: In Vitro, Over Expression, Transfection, shRNA, Plasmid Preparation
Journal: Journal of Clinical Laboratory Analysis
Article Title: A long non‐coding RNA OLBC15 promotes triple‐negative breast cancer progression via enhancing ZNF326 degradation
doi: 10.1002/jcla.23304
Figure Lengend Snippet: OLBC15 destabilizes ZNF326 by increasing ubiquitination. A, ZNF326 expression in MDA‐MB‐231 cells transfected with ShCtrl or two shOLBC15 constructs. B, ZNF326 expression in MDA‐MB‐231 cells with or without OLBC15 silence treated with DMSO (MG132‐) or MG132 (MG132+). C, Ubiquitin ligation of ZNF326 in MDA‐MB‐231 cells with or without OLBC15 depletion expressing full‐length Flag‐tagged ZNF326. D, Relative expression of ZNF326 transcripts with either OLBC15 knockdown or overexpression. E, Migration assays for MDA‐MB‐231 cells with OLBC15 knockdown and/or ZNF326 shRNA. F, Quantification data for cellular migration in (E). G, Efficiency of ZNF326 silence on ZNF326 expression. ShZNF326‐2 showed higher efficiency and was selected as ShZNF326. **: P < .01
Article Snippet: The short hairpin RNA (shRNA) for OLBC15 (ShOLBC15) together with a
Techniques: Expressing, Transfection, Construct, Ligation, Over Expression, Migration, shRNA
Journal: Cancers
Article Title: Estrogen Related Receptor Alpha (ERRα) a Bridge between Metabolism and Adrenocortical Cancer Progression
doi: 10.3390/cancers14163885
Figure Lengend Snippet: Metabolic changes in H295R cells related to ERRα expression levels. The metabolic profiles of H295R wild type (WT), shCTR, shERRα−/− and ERRα+/+ cells were assessed by Seahorse XFe96 Analyzer. ( a , b ) ATP Rate Assay was evaluated as indicated in “Materials and Methods”. Graphs represent the mean ± SD of three independent experiments of Total ATP Production Rate (pmol/min) ( a ) and ATP production (%) ( b ) deriving from glycolysis and oxidative phosphorylation after the sequential addition of specific inhibitors; (* p < 0.05 vs. WT). ( c – e ) Mitochondrial Stress Analysis was performed as indicated in “Materials and Methods”. Graphs represent the mean ± SD of three independent experiments of real-time oxygen consumption (OCR) rate (pmol/min/cells); (* p < 0.05 vs. shCTR). Mitochondrial Respiration ( c ), Basal Respiration ( d ), Maximal Respiration ( e ) were measured from OCR after the addition of specific inhibitors. ( f – h ) Glycolytic Stress Analysis was performed as indicated in “Materials and Methods”. Graph represents the mean ± SD of three independent experiments of Real-time extracellular acidification (ECAR) rate (mpH/min/cells); (* p < 0.05 vs. shCTR). Glycolitic function ( f ), Glycolysis ( g ) and Glycolytic Capacity ( h ) were measured from ECAR after the addition of specific inhibitors.
Article Snippet: After 48 h, cells were transfected with DNA plasmids: a plasmid encoding a scrambled short
Techniques: Expressing, Phospho-proteomics
Journal: Cancers
Article Title: Estrogen Related Receptor Alpha (ERRα) a Bridge between Metabolism and Adrenocortical Cancer Progression
doi: 10.3390/cancers14163885
Figure Lengend Snippet: ERRα modulates H295R cell motility and Vimentin expression. ( a , b ) H295R (WT), H295R clones, knock in (ERRα+/+) or knock out (shERRα−/−) for ERRα gene, and H295R cell stably transfected with control plasmid (shCTR) were used in Wound Healing ( a ) and Boyden Chamber ( b ) assays as reported in “Materials and Methods”. Images are from a representative experiment. ( c , d ) H295R cells were treated with vehicle (0) or XCT790 (1, 5, 10 μM) for 18 h and Wound Healing ( c ) and Boyden Chamber ( d ) assays were performed as reported in “Materials and Methods”. Images are from a representative experiment. ( c ) The wounds were observed under an inverted microscope immediately (0 h) and 18 h after the scratch (100× magnification). ( b , d ) Migrated cells were photographed under an inverted microscope and counted (see Material and Methods), 20× magnification. Graphs represent the mean ± SD of three independent experiments. The number of untreated cells (0) was set as 100% (* p < 0.05 vs. 0). ( e ) Total proteins from H295R clones (shCTR, shERRα−/−, ERRα+/+) were analyzed by western Blotting (WB) using antibodies against ERRα and Vimentin. GAPDH was used as a loading control. Blots are representative of three independent experiments with similar results. ( f ) H295R were transfected for 48 h with pcDNA3.1 non containing (EV) or containing ERRα coding sequence (pcDNA3.1-ERRα). After transfection cells were left untreated (−) or treated (+) for 24 h with XCT790 (10 μM). Total proteins were analyzed by WB using antibodies against ERRα and Vimentin. GAPDH was used as a loading control. ( g ) Cells were untreated (0) or treated with XCT790 (1, 5, 10 μM) for 24 h. Total proteins were analyzed by WB using antibodies against ERRα and Vimentin. GAPDH was used as a loading control. Original image of western blot can be found at .
Article Snippet: After 48 h, cells were transfected with DNA plasmids: a plasmid encoding a scrambled short
Techniques: Expressing, Clone Assay, Knock-In, Knock-Out, Stable Transfection, Transfection, Control, Plasmid Preparation, Inverted Microscopy, Western Blot, Sequencing
Journal: Cancers
Article Title: Estrogen Related Receptor Alpha (ERRα) a Bridge between Metabolism and Adrenocortical Cancer Progression
doi: 10.3390/cancers14163885
Figure Lengend Snippet: ERRα promotes H295R spheroids formation. ( a ) H295R were transfected for 48 h with pcDNA3.1 non containing (EV) or containing ERRα coding sequence (pcDNA3.1-ERRα) and then grown as 3D spheroids for 5 days. Spheroids were counted under an inverted microscope and results were expressed as fold change over control (EV) ± SD (TSFE, tumor spheroids formation efficiency); (* p < 0.05 vs. EV). Insert confirms ERRα overexpression. ( b ) H295R cells were left untreated (0) or treated with XCT790 (1, 5, 10 μM) for 24 h and TSFE was evaluated 5 days later (* p < 0.05 vs. 0). Images below graph are from a representative experiment (20× magnification). ( c ) Wild type H295R (WT) and H295R clones (shCTR, shERRα−/−, ERRα+/+) were used to evaluate 3D spheroids formation. TSFE was evaluated 5 days later (* p < 0.05 vs. WT). Images below graph are from a representative experiment (20× magnification). ( d ) H295R spheroids (H295R Sph-5) were allowed to grow for 5 days and then trypsinized and reseeded weekly in spheroid media for 5 weeks. Boyden Chamber Assay was performed as reported in the “Materials and Methods”. Migrated cells were randomly photographed and counted with ImageJ software (* p < 0.05 vs. WT). ( e ) H295R (WT) cells and H295R grown as spheroids for 5 weeks (H295R Sph-5), were analyzed by WB using antibody against Vimentin. GAPDH was used as a loading control. Blots are representative of three independent experiments with similar results. Original image of western blot can be found at .
Article Snippet: After 48 h, cells were transfected with DNA plasmids: a plasmid encoding a scrambled short
Techniques: Transfection, Sequencing, Inverted Microscopy, Control, Over Expression, Clone Assay, Boyden Chamber Assay, Software, Western Blot
Journal: Cancers
Article Title: Estrogen Related Receptor Alpha (ERRα) a Bridge between Metabolism and Adrenocortical Cancer Progression
doi: 10.3390/cancers14163885
Figure Lengend Snippet: ERRα expression levels and cholesterol influence H295R cell migration. ( a ) H295R clones (shCTR, ERRα+/+, shERRα−/−) were maintained in 5% FBS or 5% LpFS containing medium. Cells were used in Wound Healing ( a ) and Boyden Chamber ( b ) assays performed as reported in “Materials and Methods”. ( a ) Images are from a representative experiment (100× magnification). ( b ) Migrated cells were photographed under an inverted microscope (20× magnification) and counted with ImageJ software. Graphs represent the mean ± SD of three independent experiments (* p < 0.05 vs. FBS).
Article Snippet: After 48 h, cells were transfected with DNA plasmids: a plasmid encoding a scrambled short
Techniques: Expressing, Migration, Clone Assay, Inverted Microscopy, Software
Journal: Biofactors (Oxford, England)
Article Title: ASNS Regulates H 2 O 2 ‐Induced Senescence, Oxidative Stress, and Glucose Metabolism in ARPE ‐19 Cells by Modulating USP13 Expression
doi: 10.1002/biof.70057
Figure Lengend Snippet: ASNS enhanced H 2 O 2 ‐induced retinal cell proliferation and attenuated senescence. ARPE‐19 cells were transfected with shASNS or ASNS‐OE. (A) The mRNA expression of ASNS was detected by RT‐qPCR. (B) The protein expression of ASNS was detected by WB. ARPE‐19 cells were divided into H 2 O 2 + shCtrl, H 2 O 2 + shASNS or H 2 O 2 + NC, H 2 O 2 + ASNS‐OE groups. (C) CCK8 assay was utilized to assess cell viability in H 2 O 2 ‐treated ARPE‐19 cells. (D) SA‐β‐gal staining experiments were conducted in the above groups. (E) Measurement of intracellular ROS in the above groups. (F) The protein expression of P53, P21, P16 was detected by WB. (G) The level of GSH and MDA detected by ELISA. Data are presented as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.
Article Snippet: Lentiviral vectors interfering with ASNS and USP13 expression (shASNS and shUSP13) and the negative
Techniques: Transfection, Expressing, Quantitative RT-PCR, CCK-8 Assay, Staining, Enzyme-linked Immunosorbent Assay
Journal: Biofactors (Oxford, England)
Article Title: ASNS Regulates H 2 O 2 ‐Induced Senescence, Oxidative Stress, and Glucose Metabolism in ARPE ‐19 Cells by Modulating USP13 Expression
doi: 10.1002/biof.70057
Figure Lengend Snippet: ASNS regulated glucose metabolism pathways in H 2 O 2 ‐induced retinal cells. ARPE‐19 cells were divided into H 2 O 2 + shCtrl, H 2 O 2 + shASNS or H 2 O 2 + NC, H 2 O 2 + ASNS‐OE groups. (A) Detection of glucose uptake using a kit in H 2 O 2 ‐treated ARPE‐19 cells. (B) Detection of lactate production using a kit in H 2 O 2 ‐treated ARPE‐19 cells. (C) Measuring ECAR in H 2 O 2 ‐treated ARPE‐19 cells using the XF‐96 extracellular flux analyzer. (D) Measuring OCR in H 2 O 2 ‐treated ARPE‐19 cells using the XF‐96 extracellular flux analyzer. (E) The mRNA expression of Glut1, Glut4, HK2, and PGK1was detected by RT‐qPCR. (F) The protein expression of Glut1, Glut4, HK2, and PGK1was detected by WB. (G) The protein expression of HIF‐1α was detected by WB. Data are presented as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.
Article Snippet: Lentiviral vectors interfering with ASNS and USP13 expression (shASNS and shUSP13) and the negative
Techniques: Expressing, Quantitative RT-PCR
Journal: Biofactors (Oxford, England)
Article Title: ASNS Regulates H 2 O 2 ‐Induced Senescence, Oxidative Stress, and Glucose Metabolism in ARPE ‐19 Cells by Modulating USP13 Expression
doi: 10.1002/biof.70057
Figure Lengend Snippet: Validation of ASNS's impact on the AMD disease process in vivo. Sprague–Dawley rats injected with sodium iodate (30 mg/kg body weight) and divided into MOCK group (No lentivirus injections, n = 10), shCtrl group (Injection of shCtrl lentivirus, n = 10), and shASNS (Injection of shASNS lentivirus, n = 10) group. (A) H&E staining analysis of rat retinal tissues in each group. (B) SA‐β‐gal staining of rat retinal tissues were conducted in the above groups. (C) Measuring ECAR and OCR in retinal tissues using the XF‐96 extracellular flux analyzer. (D) The mRNA expression of Glut1, Glut4, HK2, and PGK1 in retinal tissues was detected by RT‐qPCR. (E) The protein expression of Glut1, Glut4, HK2, and PGK1 in retinal tissues was detected by WB. (F) The protein expression of ASNS and USP13 in retinal tissues was detected by WB. (G) IF was used to analyze the expression of ASNS and USP1 in retinal tissues. (H) The protein expression of HIF‐1α in retinal tissues was detected by WB. Data are presented as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.
Article Snippet: Lentiviral vectors interfering with ASNS and USP13 expression (shASNS and shUSP13) and the negative
Techniques: Biomarker Discovery, In Vivo, Injection, Staining, Expressing, Quantitative RT-PCR
Journal: Biofactors (Oxford, England)
Article Title: ASNS Regulates H 2 O 2 ‐Induced Senescence, Oxidative Stress, and Glucose Metabolism in ARPE ‐19 Cells by Modulating USP13 Expression
doi: 10.1002/biof.70057
Figure Lengend Snippet: Validation of USP13's impact on the AMD disease process in vivo. Sprague–Dawley rats injected with sodium iodate (30 mg/kg body weigh) and divided into MOCK group (No lentivirus injections, n = 10), shCtrl group (Injection of shCtrl lentivirus, n = 10), and shUSP13 (Injection of shUSP13 lentivirus, n = 10) group. (A) H&E staining analysis of rat retinal tissues in each group. (B) SA‐β‐gal staining of rat retinal tissues were conducted in the above groups. (C) Measuring ECAR and OCR in retinal tissues using the XF‐96 extracellular flux analyzer. (D) The mRNA expression of Glut1, Glut4, HK2, and PGK1 in retinal tissues was detected by RT‐qPCR. (E) The protein expression of Glut1, Glut4, HK2, and PGK1 in retinal tissues was detected by WB. (F) The protein expression of USP13 in retinal tissues was detected by WB. (G) The protein expression of HIF‐1α in retinal tissues was detected by WB. Data are presented as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.
Article Snippet: Lentiviral vectors interfering with ASNS and USP13 expression (shASNS and shUSP13) and the negative
Techniques: Biomarker Discovery, In Vivo, Injection, Staining, Expressing, Quantitative RT-PCR