a scramble control sequence (shctrl) Search Results


93
Addgene inc shcontrol scrambled cgcgaagtctgtactcttg
High-content imaging analysis of glucosomes from Hs578T cells. A , the percentages (%) of EGF-treated Hs578T cells displaying each size of PFKL-mEGFP assemblies were quantified from at least three independent imaging sessions in the presence of SCH772984 ( gray ), shERK1 ( yellow ), shERK2 ( blue ), or <t>shControl</t> Scrambled ( green ). Note that the previously reported distributions of glucosomes in various sizes in the absence and presence of 30 ng/ml EGF ( purple and red , respectively) are also graphed together for direct comparison. B , a table shows the average percentages (%) of Hs578T cells displaying the given sized glucosomes at each condition along with their SDs (±). Statistical analyses were performed using Tukey’s multiple comparison tests for two-way ANOVA analysis. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.0001. N.S.; not significant. EGF, epidermal growth factor; mEGFP, monomeric enhanced GFP; PFKL, liver-type phosphofructokinase 1.
Shcontrol Scrambled Cgcgaagtctgtactcttg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shcontrol scrambled cgcgaagtctgtactcttg/product/Addgene inc
Average 93 stars, based on 1 article reviews
shcontrol scrambled cgcgaagtctgtactcttg - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology scramble shctr sc 108080 rna particles
High-content imaging analysis of glucosomes from Hs578T cells. A , the percentages (%) of EGF-treated Hs578T cells displaying each size of PFKL-mEGFP assemblies were quantified from at least three independent imaging sessions in the presence of SCH772984 ( gray ), shERK1 ( yellow ), shERK2 ( blue ), or <t>shControl</t> Scrambled ( green ). Note that the previously reported distributions of glucosomes in various sizes in the absence and presence of 30 ng/ml EGF ( purple and red , respectively) are also graphed together for direct comparison. B , a table shows the average percentages (%) of Hs578T cells displaying the given sized glucosomes at each condition along with their SDs (±). Statistical analyses were performed using Tukey’s multiple comparison tests for two-way ANOVA analysis. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.0001. N.S.; not significant. EGF, epidermal growth factor; mEGFP, monomeric enhanced GFP; PFKL, liver-type phosphofructokinase 1.
Scramble Shctr Sc 108080 Rna Particles, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/scramble shctr sc 108080 rna particles/product/Santa Cruz Biotechnology
Average 96 stars, based on 1 article reviews
scramble shctr sc 108080 rna particles - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

90
SuperArray Bioscience Corporation shctrl scrambled sequence
High-content imaging analysis of glucosomes from Hs578T cells. A , the percentages (%) of EGF-treated Hs578T cells displaying each size of PFKL-mEGFP assemblies were quantified from at least three independent imaging sessions in the presence of SCH772984 ( gray ), shERK1 ( yellow ), shERK2 ( blue ), or <t>shControl</t> Scrambled ( green ). Note that the previously reported distributions of glucosomes in various sizes in the absence and presence of 30 ng/ml EGF ( purple and red , respectively) are also graphed together for direct comparison. B , a table shows the average percentages (%) of Hs578T cells displaying the given sized glucosomes at each condition along with their SDs (±). Statistical analyses were performed using Tukey’s multiple comparison tests for two-way ANOVA analysis. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.0001. N.S.; not significant. EGF, epidermal growth factor; mEGFP, monomeric enhanced GFP; PFKL, liver-type phosphofructokinase 1.
Shctrl Scrambled Sequence, supplied by SuperArray Bioscience Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shctrl scrambled sequence/product/SuperArray Bioscience Corporation
Average 90 stars, based on 1 article reviews
shctrl scrambled sequence - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

96
Addgene inc shctrl 1
VRK3 impair chromosome segregation/affect chromatin dynamics in DMG (A) Hierarchical clustering and heatmap of modulated genes after VRK3 KD involved in chromosome segregation (Gene Ontology GO:0044843). (B) Protein modulation of VRK3, ERK and MSK2 96 h after transduction with <t>shCTRL-1</t> or shVRK3-4. Cyclophilin was used as loading control. (C) Western Blot analysis showing levels of H3S10P in GSC1, GSC2 (H3.3-K27M model) and GSC3, GSC4 (H3.1-K27M) with or without nocodazole treatment. Histone H4 was used as loading control. (D, E) Western Blot analysis showing levels of H3S10P and H3S28P in H3.3-K27M GSC1 and H3.1-K27M GSC4 with or without nocodazole treatment 168h after transduction with shCTRL-1 or shVRK3-4. Histone H4 was used as loading control. (F) Protein modulation of VRK1 and VRK3 168h after transduction in GSC1. Cyclophilin was used as loading control.
Shctrl 1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shctrl 1/product/Addgene inc
Average 96 stars, based on 1 article reviews
shctrl 1 - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology constitutive promoter
VRK3 impair chromosome segregation/affect chromatin dynamics in DMG (A) Hierarchical clustering and heatmap of modulated genes after VRK3 KD involved in chromosome segregation (Gene Ontology GO:0044843). (B) Protein modulation of VRK3, ERK and MSK2 96 h after transduction with <t>shCTRL-1</t> or shVRK3-4. Cyclophilin was used as loading control. (C) Western Blot analysis showing levels of H3S10P in GSC1, GSC2 (H3.3-K27M model) and GSC3, GSC4 (H3.1-K27M) with or without nocodazole treatment. Histone H4 was used as loading control. (D, E) Western Blot analysis showing levels of H3S10P and H3S28P in H3.3-K27M GSC1 and H3.1-K27M GSC4 with or without nocodazole treatment 168h after transduction with shCTRL-1 or shVRK3-4. Histone H4 was used as loading control. (F) Protein modulation of VRK1 and VRK3 168h after transduction in GSC1. Cyclophilin was used as loading control.
Constitutive Promoter, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/constitutive promoter/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
constitutive promoter - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

90
BioVector Inc non targeting scrambled control (shctrl
OLBC15 promotes TNBC in vitro. A, Overexpression efficiency by lentiviral OLBC15 transfection. B, Knockdown efficiency <t>using</t> <t>shRNA</t> targeting OLBC15. ShOLBC15 displayed higher efficiency and was selected as ShOLBC15. C‐D, Effect of OLBC15 on viability of BT‐549 (C) and MDA‐MB‐231 (D) cells transfected with shRNA scrambled control <t>(ShCtrl),</t> ShOLBC15, lentiviral control (OE‐control), or the lentiviral vector carrying OLBC15 (OE‐OLBC15). E, Effect of OLBC15 on migratory capacity of MDA‐MB‐231 (top) and BT‐549 (bottom) cells. F, Quantification of results in (E). **: P < .01
Non Targeting Scrambled Control (Shctrl, supplied by BioVector Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/non targeting scrambled control (shctrl/product/BioVector Inc
Average 90 stars, based on 1 article reviews
non targeting scrambled control (shctrl - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

93
Addgene inc plko 1 shctrl puro target sequence 5 cctaaggttaagtcgccctcg 3
OLBC15 promotes TNBC in vitro. A, Overexpression efficiency by lentiviral OLBC15 transfection. B, Knockdown efficiency <t>using</t> <t>shRNA</t> targeting OLBC15. ShOLBC15 displayed higher efficiency and was selected as ShOLBC15. C‐D, Effect of OLBC15 on viability of BT‐549 (C) and MDA‐MB‐231 (D) cells transfected with shRNA scrambled control <t>(ShCtrl),</t> ShOLBC15, lentiviral control (OE‐control), or the lentiviral vector carrying OLBC15 (OE‐OLBC15). E, Effect of OLBC15 on migratory capacity of MDA‐MB‐231 (top) and BT‐549 (bottom) cells. F, Quantification of results in (E). **: P < .01
Plko 1 Shctrl Puro Target Sequence 5 Cctaaggttaagtcgccctcg 3, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plko 1 shctrl puro target sequence 5 cctaaggttaagtcgccctcg 3/product/Addgene inc
Average 93 stars, based on 1 article reviews
plko 1 shctrl puro target sequence 5 cctaaggttaagtcgccctcg 3 - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

96
OriGene scramble control
OLBC15 promotes TNBC in vitro. A, Overexpression efficiency by lentiviral OLBC15 transfection. B, Knockdown efficiency <t>using</t> <t>shRNA</t> targeting OLBC15. ShOLBC15 displayed higher efficiency and was selected as ShOLBC15. C‐D, Effect of OLBC15 on viability of BT‐549 (C) and MDA‐MB‐231 (D) cells transfected with shRNA scrambled control <t>(ShCtrl),</t> ShOLBC15, lentiviral control (OE‐control), or the lentiviral vector carrying OLBC15 (OE‐OLBC15). E, Effect of OLBC15 on migratory capacity of MDA‐MB‐231 (top) and BT‐549 (bottom) cells. F, Quantification of results in (E). **: P < .01
Scramble Control, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/scramble control/product/OriGene
Average 96 stars, based on 1 article reviews
scramble control - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology hairpin rnas shrna sequence sequence shctr
Metabolic changes in H295R cells related to ERRα expression levels. The metabolic profiles of H295R wild type (WT), <t>shCTR,</t> shERRα−/− and ERRα+/+ cells were assessed by Seahorse XFe96 Analyzer. ( a , b ) ATP Rate Assay was evaluated as indicated in “Materials and Methods”. Graphs represent the mean ± SD of three independent experiments of Total ATP Production Rate (pmol/min) ( a ) and ATP production (%) ( b ) deriving from glycolysis and oxidative phosphorylation after the sequential addition of specific inhibitors; (* p < 0.05 vs. WT). ( c – e ) Mitochondrial Stress Analysis was performed as indicated in “Materials and Methods”. Graphs represent the mean ± SD of three independent experiments of real-time oxygen consumption (OCR) rate (pmol/min/cells); (* p < 0.05 vs. shCTR). Mitochondrial Respiration ( c ), Basal Respiration ( d ), Maximal Respiration ( e ) were measured from OCR after the addition of specific inhibitors. ( f – h ) Glycolytic Stress Analysis was performed as indicated in “Materials and Methods”. Graph represents the mean ± SD of three independent experiments of Real-time extracellular acidification (ECAR) rate (mpH/min/cells); (* p < 0.05 vs. shCTR). Glycolitic function ( f ), Glycolysis ( g ) and Glycolytic Capacity ( h ) were measured from ECAR after the addition of specific inhibitors.
Hairpin Rnas Shrna Sequence Sequence Shctr, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hairpin rnas shrna sequence sequence shctr/product/Santa Cruz Biotechnology
Average 96 stars, based on 1 article reviews
hairpin rnas shrna sequence sequence shctr - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

90
OriGene rat shrna constructs against nr4a1
Metabolic changes in H295R cells related to ERRα expression levels. The metabolic profiles of H295R wild type (WT), <t>shCTR,</t> shERRα−/− and ERRα+/+ cells were assessed by Seahorse XFe96 Analyzer. ( a , b ) ATP Rate Assay was evaluated as indicated in “Materials and Methods”. Graphs represent the mean ± SD of three independent experiments of Total ATP Production Rate (pmol/min) ( a ) and ATP production (%) ( b ) deriving from glycolysis and oxidative phosphorylation after the sequential addition of specific inhibitors; (* p < 0.05 vs. WT). ( c – e ) Mitochondrial Stress Analysis was performed as indicated in “Materials and Methods”. Graphs represent the mean ± SD of three independent experiments of real-time oxygen consumption (OCR) rate (pmol/min/cells); (* p < 0.05 vs. shCTR). Mitochondrial Respiration ( c ), Basal Respiration ( d ), Maximal Respiration ( e ) were measured from OCR after the addition of specific inhibitors. ( f – h ) Glycolytic Stress Analysis was performed as indicated in “Materials and Methods”. Graph represents the mean ± SD of three independent experiments of Real-time extracellular acidification (ECAR) rate (mpH/min/cells); (* p < 0.05 vs. shCTR). Glycolitic function ( f ), Glycolysis ( g ) and Glycolytic Capacity ( h ) were measured from ECAR after the addition of specific inhibitors.
Rat Shrna Constructs Against Nr4a1, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rat shrna constructs against nr4a1/product/OriGene
Average 90 stars, based on 1 article reviews
rat shrna constructs against nr4a1 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

86
Genechem aav9 shctrl
Metabolic changes in H295R cells related to ERRα expression levels. The metabolic profiles of H295R wild type (WT), <t>shCTR,</t> shERRα−/− and ERRα+/+ cells were assessed by Seahorse XFe96 Analyzer. ( a , b ) ATP Rate Assay was evaluated as indicated in “Materials and Methods”. Graphs represent the mean ± SD of three independent experiments of Total ATP Production Rate (pmol/min) ( a ) and ATP production (%) ( b ) deriving from glycolysis and oxidative phosphorylation after the sequential addition of specific inhibitors; (* p < 0.05 vs. WT). ( c – e ) Mitochondrial Stress Analysis was performed as indicated in “Materials and Methods”. Graphs represent the mean ± SD of three independent experiments of real-time oxygen consumption (OCR) rate (pmol/min/cells); (* p < 0.05 vs. shCTR). Mitochondrial Respiration ( c ), Basal Respiration ( d ), Maximal Respiration ( e ) were measured from OCR after the addition of specific inhibitors. ( f – h ) Glycolytic Stress Analysis was performed as indicated in “Materials and Methods”. Graph represents the mean ± SD of three independent experiments of Real-time extracellular acidification (ECAR) rate (mpH/min/cells); (* p < 0.05 vs. shCTR). Glycolitic function ( f ), Glycolysis ( g ) and Glycolytic Capacity ( h ) were measured from ECAR after the addition of specific inhibitors.
Aav9 Shctrl, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aav9 shctrl/product/Genechem
Average 86 stars, based on 1 article reviews
aav9 shctrl - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

90
SLIT2 LTD slit2 knockdown
Metabolic changes in H295R cells related to ERRα expression levels. The metabolic profiles of H295R wild type (WT), <t>shCTR,</t> shERRα−/− and ERRα+/+ cells were assessed by Seahorse XFe96 Analyzer. ( a , b ) ATP Rate Assay was evaluated as indicated in “Materials and Methods”. Graphs represent the mean ± SD of three independent experiments of Total ATP Production Rate (pmol/min) ( a ) and ATP production (%) ( b ) deriving from glycolysis and oxidative phosphorylation after the sequential addition of specific inhibitors; (* p < 0.05 vs. WT). ( c – e ) Mitochondrial Stress Analysis was performed as indicated in “Materials and Methods”. Graphs represent the mean ± SD of three independent experiments of real-time oxygen consumption (OCR) rate (pmol/min/cells); (* p < 0.05 vs. shCTR). Mitochondrial Respiration ( c ), Basal Respiration ( d ), Maximal Respiration ( e ) were measured from OCR after the addition of specific inhibitors. ( f – h ) Glycolytic Stress Analysis was performed as indicated in “Materials and Methods”. Graph represents the mean ± SD of three independent experiments of Real-time extracellular acidification (ECAR) rate (mpH/min/cells); (* p < 0.05 vs. shCTR). Glycolitic function ( f ), Glycolysis ( g ) and Glycolytic Capacity ( h ) were measured from ECAR after the addition of specific inhibitors.
Slit2 Knockdown, supplied by SLIT2 LTD, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/slit2 knockdown/product/SLIT2 LTD
Average 90 stars, based on 1 article reviews
slit2 knockdown - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

Image Search Results


High-content imaging analysis of glucosomes from Hs578T cells. A , the percentages (%) of EGF-treated Hs578T cells displaying each size of PFKL-mEGFP assemblies were quantified from at least three independent imaging sessions in the presence of SCH772984 ( gray ), shERK1 ( yellow ), shERK2 ( blue ), or shControl Scrambled ( green ). Note that the previously reported distributions of glucosomes in various sizes in the absence and presence of 30 ng/ml EGF ( purple and red , respectively) are also graphed together for direct comparison. B , a table shows the average percentages (%) of Hs578T cells displaying the given sized glucosomes at each condition along with their SDs (±). Statistical analyses were performed using Tukey’s multiple comparison tests for two-way ANOVA analysis. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.0001. N.S.; not significant. EGF, epidermal growth factor; mEGFP, monomeric enhanced GFP; PFKL, liver-type phosphofructokinase 1.

Journal: The Journal of Biological Chemistry

Article Title: Subcellular regulation of glucose metabolism through multienzyme glucosome assemblies by EGF–ERK1/2 signaling pathways

doi: 10.1016/j.jbc.2022.101675

Figure Lengend Snippet: High-content imaging analysis of glucosomes from Hs578T cells. A , the percentages (%) of EGF-treated Hs578T cells displaying each size of PFKL-mEGFP assemblies were quantified from at least three independent imaging sessions in the presence of SCH772984 ( gray ), shERK1 ( yellow ), shERK2 ( blue ), or shControl Scrambled ( green ). Note that the previously reported distributions of glucosomes in various sizes in the absence and presence of 30 ng/ml EGF ( purple and red , respectively) are also graphed together for direct comparison. B , a table shows the average percentages (%) of Hs578T cells displaying the given sized glucosomes at each condition along with their SDs (±). Statistical analyses were performed using Tukey’s multiple comparison tests for two-way ANOVA analysis. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.0001. N.S.; not significant. EGF, epidermal growth factor; mEGFP, monomeric enhanced GFP; PFKL, liver-type phosphofructokinase 1.

Article Snippet: Hs578T cells were transfected with shRNAs targeting ERK1/2 (shERK1 and shERK2) and a control shRNA with a scrambled sequence (shControl Scrambled , CGCGAAGTCTGTACTCTTG, Addgene, Cat# 65232) ( ) using Lipofectamine 2000.

Techniques: Imaging

Western blot analysis of ERK1/2 knockdown. Epidermal growth factor-treated Hs578T cells were transfected with shERK1, shERK2, or shControl Scrambled and subsequently selected in the presence of puromycin (1 μg/ml). A , Western blot analysis showed the knockdown of total ERK1/2, but no change was detected for pERK1/2 in the presence of shERK1/2. B and C , expression levels of total ERK1/2 and phosphorylated ERK1/2 (pERK1/2) were normalized based on load controls (β-actin), respectively. The error bars represent the SDs of at least three independent experiments. Statistical analyses were performed using two-sample two-tailed t test. ∗ p < 0.05, ∗∗ p < 0.01. N.S.; not significant. ERK, extracellular signal-regulated kinase.

Journal: The Journal of Biological Chemistry

Article Title: Subcellular regulation of glucose metabolism through multienzyme glucosome assemblies by EGF–ERK1/2 signaling pathways

doi: 10.1016/j.jbc.2022.101675

Figure Lengend Snippet: Western blot analysis of ERK1/2 knockdown. Epidermal growth factor-treated Hs578T cells were transfected with shERK1, shERK2, or shControl Scrambled and subsequently selected in the presence of puromycin (1 μg/ml). A , Western blot analysis showed the knockdown of total ERK1/2, but no change was detected for pERK1/2 in the presence of shERK1/2. B and C , expression levels of total ERK1/2 and phosphorylated ERK1/2 (pERK1/2) were normalized based on load controls (β-actin), respectively. The error bars represent the SDs of at least three independent experiments. Statistical analyses were performed using two-sample two-tailed t test. ∗ p < 0.05, ∗∗ p < 0.01. N.S.; not significant. ERK, extracellular signal-regulated kinase.

Article Snippet: Hs578T cells were transfected with shRNAs targeting ERK1/2 (shERK1 and shERK2) and a control shRNA with a scrambled sequence (shControl Scrambled , CGCGAAGTCTGTACTCTTG, Addgene, Cat# 65232) ( ) using Lipofectamine 2000.

Techniques: Western Blot, Transfection, Expressing, Two Tailed Test

VRK3 impair chromosome segregation/affect chromatin dynamics in DMG (A) Hierarchical clustering and heatmap of modulated genes after VRK3 KD involved in chromosome segregation (Gene Ontology GO:0044843). (B) Protein modulation of VRK3, ERK and MSK2 96 h after transduction with shCTRL-1 or shVRK3-4. Cyclophilin was used as loading control. (C) Western Blot analysis showing levels of H3S10P in GSC1, GSC2 (H3.3-K27M model) and GSC3, GSC4 (H3.1-K27M) with or without nocodazole treatment. Histone H4 was used as loading control. (D, E) Western Blot analysis showing levels of H3S10P and H3S28P in H3.3-K27M GSC1 and H3.1-K27M GSC4 with or without nocodazole treatment 168h after transduction with shCTRL-1 or shVRK3-4. Histone H4 was used as loading control. (F) Protein modulation of VRK1 and VRK3 168h after transduction in GSC1. Cyclophilin was used as loading control.

Journal: Frontiers in Oncology

Article Title: VRK3 depletion induces cell cycle arrest and metabolic reprogramming of pontine diffuse midline glioma - H3K27 altered cells

doi: 10.3389/fonc.2023.1229312

Figure Lengend Snippet: VRK3 impair chromosome segregation/affect chromatin dynamics in DMG (A) Hierarchical clustering and heatmap of modulated genes after VRK3 KD involved in chromosome segregation (Gene Ontology GO:0044843). (B) Protein modulation of VRK3, ERK and MSK2 96 h after transduction with shCTRL-1 or shVRK3-4. Cyclophilin was used as loading control. (C) Western Blot analysis showing levels of H3S10P in GSC1, GSC2 (H3.3-K27M model) and GSC3, GSC4 (H3.1-K27M) with or without nocodazole treatment. Histone H4 was used as loading control. (D, E) Western Blot analysis showing levels of H3S10P and H3S28P in H3.3-K27M GSC1 and H3.1-K27M GSC4 with or without nocodazole treatment 168h after transduction with shCTRL-1 or shVRK3-4. Histone H4 was used as loading control. (F) Protein modulation of VRK1 and VRK3 168h after transduction in GSC1. Cyclophilin was used as loading control.

Article Snippet: GSCs were transduced at a multiplicity of infection (M.O.I.) of 3 with shVRK3-1, shVRK3-4, shCtrl-1 (negative control vector containing a nonhairpin insert Addgene #1864) and shCtrl-2 (MISSION ® pLKO.1-puro non-mammalian shRNA Control Plasmid DNA, SHC002, Sigma-Aldrich).

Techniques: Transduction, Western Blot

VRK3 inhibition led to DMG-H3K27M altered G1 growth cell arrest (A) Two-dimensional plots (EdU vs. FxCycle Violet stain) of GSC4 cells 96h hours after transduction with shCtrl-1, shCtrl-2, shVRK3-1 and shVRK3-4 and quantification of the different cell-cycle population. At least thirty thousand cells were recorded for each condition, triplicates were performed for each GSC model except duplicates for GSC3 cells. (B) Histogram presenting percentage of the different cell-cycle populations in GSC cells (H3.3-K27M models GSC1, GSC2 in light green, H3.1-K27M models GSC3, GSC4 in dark green) 96h after transduction at M.O.I. 3 with shCTRL-1, shCTRL-2, shVRK3-1 and shVRK3-4. At least thirty thousand cells were recorded for each condition, quadriplicates were performed for each GSC model except duplicates for GSC3 cells. (C) Hierarchical clustering of DEGs in shVRK3 versus shCTRL belonging to cell cycle G1/S phase transition geneset (Gene Ontology GO:0007059). Heatmap shows RNAseq expression level (Z-score on normalized expression matrix) (D) Bar charts presenting modulation of CDK and CDK inhibitors in H3.3 and H3.1-mutated cells after VRK3 KD. Gene modulation is presented as the log2FC of RNAseq data on y-axis and the significance is encoded by color transparency. (E) Western Blot analysis showing levels of P27, P21 and P16 in GSC1 and GSC2 (H3.3-K27M model) and GSC4 (H3.1-K27M) 96h or 168h after transduction with shCtrl-1 or shVRK3-4. Cyclophilin was used as loading control. Densimetric quantification of western blot was processed with Image Lab and P27 protein level was normalized to cyclophilin expression.

Journal: Frontiers in Oncology

Article Title: VRK3 depletion induces cell cycle arrest and metabolic reprogramming of pontine diffuse midline glioma - H3K27 altered cells

doi: 10.3389/fonc.2023.1229312

Figure Lengend Snippet: VRK3 inhibition led to DMG-H3K27M altered G1 growth cell arrest (A) Two-dimensional plots (EdU vs. FxCycle Violet stain) of GSC4 cells 96h hours after transduction with shCtrl-1, shCtrl-2, shVRK3-1 and shVRK3-4 and quantification of the different cell-cycle population. At least thirty thousand cells were recorded for each condition, triplicates were performed for each GSC model except duplicates for GSC3 cells. (B) Histogram presenting percentage of the different cell-cycle populations in GSC cells (H3.3-K27M models GSC1, GSC2 in light green, H3.1-K27M models GSC3, GSC4 in dark green) 96h after transduction at M.O.I. 3 with shCTRL-1, shCTRL-2, shVRK3-1 and shVRK3-4. At least thirty thousand cells were recorded for each condition, quadriplicates were performed for each GSC model except duplicates for GSC3 cells. (C) Hierarchical clustering of DEGs in shVRK3 versus shCTRL belonging to cell cycle G1/S phase transition geneset (Gene Ontology GO:0007059). Heatmap shows RNAseq expression level (Z-score on normalized expression matrix) (D) Bar charts presenting modulation of CDK and CDK inhibitors in H3.3 and H3.1-mutated cells after VRK3 KD. Gene modulation is presented as the log2FC of RNAseq data on y-axis and the significance is encoded by color transparency. (E) Western Blot analysis showing levels of P27, P21 and P16 in GSC1 and GSC2 (H3.3-K27M model) and GSC4 (H3.1-K27M) 96h or 168h after transduction with shCtrl-1 or shVRK3-4. Cyclophilin was used as loading control. Densimetric quantification of western blot was processed with Image Lab and P27 protein level was normalized to cyclophilin expression.

Article Snippet: GSCs were transduced at a multiplicity of infection (M.O.I.) of 3 with shVRK3-1, shVRK3-4, shCtrl-1 (negative control vector containing a nonhairpin insert Addgene #1864) and shCtrl-2 (MISSION ® pLKO.1-puro non-mammalian shRNA Control Plasmid DNA, SHC002, Sigma-Aldrich).

Techniques: Inhibition, Staining, Transduction, Sublimation, Expressing, Western Blot

OLBC15 promotes TNBC in vitro. A, Overexpression efficiency by lentiviral OLBC15 transfection. B, Knockdown efficiency using shRNA targeting OLBC15. ShOLBC15 displayed higher efficiency and was selected as ShOLBC15. C‐D, Effect of OLBC15 on viability of BT‐549 (C) and MDA‐MB‐231 (D) cells transfected with shRNA scrambled control (ShCtrl), ShOLBC15, lentiviral control (OE‐control), or the lentiviral vector carrying OLBC15 (OE‐OLBC15). E, Effect of OLBC15 on migratory capacity of MDA‐MB‐231 (top) and BT‐549 (bottom) cells. F, Quantification of results in (E). **: P < .01

Journal: Journal of Clinical Laboratory Analysis

Article Title: A long non‐coding RNA OLBC15 promotes triple‐negative breast cancer progression via enhancing ZNF326 degradation

doi: 10.1002/jcla.23304

Figure Lengend Snippet: OLBC15 promotes TNBC in vitro. A, Overexpression efficiency by lentiviral OLBC15 transfection. B, Knockdown efficiency using shRNA targeting OLBC15. ShOLBC15 displayed higher efficiency and was selected as ShOLBC15. C‐D, Effect of OLBC15 on viability of BT‐549 (C) and MDA‐MB‐231 (D) cells transfected with shRNA scrambled control (ShCtrl), ShOLBC15, lentiviral control (OE‐control), or the lentiviral vector carrying OLBC15 (OE‐OLBC15). E, Effect of OLBC15 on migratory capacity of MDA‐MB‐231 (top) and BT‐549 (bottom) cells. F, Quantification of results in (E). **: P < .01

Article Snippet: The short hairpin RNA (shRNA) for OLBC15 (ShOLBC15) together with a non‐targeting scrambled control (ShCtrl) was obtained from Biovector.

Techniques: In Vitro, Over Expression, Transfection, shRNA, Plasmid Preparation

OLBC15 destabilizes ZNF326 by increasing ubiquitination. A, ZNF326 expression in MDA‐MB‐231 cells transfected with ShCtrl or two shOLBC15 constructs. B, ZNF326 expression in MDA‐MB‐231 cells with or without OLBC15 silence treated with DMSO (MG132‐) or MG132 (MG132+). C, Ubiquitin ligation of ZNF326 in MDA‐MB‐231 cells with or without OLBC15 depletion expressing full‐length Flag‐tagged ZNF326. D, Relative expression of ZNF326 transcripts with either OLBC15 knockdown or overexpression. E, Migration assays for MDA‐MB‐231 cells with OLBC15 knockdown and/or ZNF326 shRNA. F, Quantification data for cellular migration in (E). G, Efficiency of ZNF326 silence on ZNF326 expression. ShZNF326‐2 showed higher efficiency and was selected as ShZNF326. **: P < .01

Journal: Journal of Clinical Laboratory Analysis

Article Title: A long non‐coding RNA OLBC15 promotes triple‐negative breast cancer progression via enhancing ZNF326 degradation

doi: 10.1002/jcla.23304

Figure Lengend Snippet: OLBC15 destabilizes ZNF326 by increasing ubiquitination. A, ZNF326 expression in MDA‐MB‐231 cells transfected with ShCtrl or two shOLBC15 constructs. B, ZNF326 expression in MDA‐MB‐231 cells with or without OLBC15 silence treated with DMSO (MG132‐) or MG132 (MG132+). C, Ubiquitin ligation of ZNF326 in MDA‐MB‐231 cells with or without OLBC15 depletion expressing full‐length Flag‐tagged ZNF326. D, Relative expression of ZNF326 transcripts with either OLBC15 knockdown or overexpression. E, Migration assays for MDA‐MB‐231 cells with OLBC15 knockdown and/or ZNF326 shRNA. F, Quantification data for cellular migration in (E). G, Efficiency of ZNF326 silence on ZNF326 expression. ShZNF326‐2 showed higher efficiency and was selected as ShZNF326. **: P < .01

Article Snippet: The short hairpin RNA (shRNA) for OLBC15 (ShOLBC15) together with a non‐targeting scrambled control (ShCtrl) was obtained from Biovector.

Techniques: Expressing, Transfection, Construct, Ligation, Over Expression, Migration, shRNA

Metabolic changes in H295R cells related to ERRα expression levels. The metabolic profiles of H295R wild type (WT), shCTR, shERRα−/− and ERRα+/+ cells were assessed by Seahorse XFe96 Analyzer. ( a , b ) ATP Rate Assay was evaluated as indicated in “Materials and Methods”. Graphs represent the mean ± SD of three independent experiments of Total ATP Production Rate (pmol/min) ( a ) and ATP production (%) ( b ) deriving from glycolysis and oxidative phosphorylation after the sequential addition of specific inhibitors; (* p < 0.05 vs. WT). ( c – e ) Mitochondrial Stress Analysis was performed as indicated in “Materials and Methods”. Graphs represent the mean ± SD of three independent experiments of real-time oxygen consumption (OCR) rate (pmol/min/cells); (* p < 0.05 vs. shCTR). Mitochondrial Respiration ( c ), Basal Respiration ( d ), Maximal Respiration ( e ) were measured from OCR after the addition of specific inhibitors. ( f – h ) Glycolytic Stress Analysis was performed as indicated in “Materials and Methods”. Graph represents the mean ± SD of three independent experiments of Real-time extracellular acidification (ECAR) rate (mpH/min/cells); (* p < 0.05 vs. shCTR). Glycolitic function ( f ), Glycolysis ( g ) and Glycolytic Capacity ( h ) were measured from ECAR after the addition of specific inhibitors.

Journal: Cancers

Article Title: Estrogen Related Receptor Alpha (ERRα) a Bridge between Metabolism and Adrenocortical Cancer Progression

doi: 10.3390/cancers14163885

Figure Lengend Snippet: Metabolic changes in H295R cells related to ERRα expression levels. The metabolic profiles of H295R wild type (WT), shCTR, shERRα−/− and ERRα+/+ cells were assessed by Seahorse XFe96 Analyzer. ( a , b ) ATP Rate Assay was evaluated as indicated in “Materials and Methods”. Graphs represent the mean ± SD of three independent experiments of Total ATP Production Rate (pmol/min) ( a ) and ATP production (%) ( b ) deriving from glycolysis and oxidative phosphorylation after the sequential addition of specific inhibitors; (* p < 0.05 vs. WT). ( c – e ) Mitochondrial Stress Analysis was performed as indicated in “Materials and Methods”. Graphs represent the mean ± SD of three independent experiments of real-time oxygen consumption (OCR) rate (pmol/min/cells); (* p < 0.05 vs. shCTR). Mitochondrial Respiration ( c ), Basal Respiration ( d ), Maximal Respiration ( e ) were measured from OCR after the addition of specific inhibitors. ( f – h ) Glycolytic Stress Analysis was performed as indicated in “Materials and Methods”. Graph represents the mean ± SD of three independent experiments of Real-time extracellular acidification (ECAR) rate (mpH/min/cells); (* p < 0.05 vs. shCTR). Glycolitic function ( f ), Glycolysis ( g ) and Glycolytic Capacity ( h ) were measured from ECAR after the addition of specific inhibitors.

Article Snippet: After 48 h, cells were transfected with DNA plasmids: a plasmid encoding a scrambled short hairpin RNAs (shRNA) sequence (shCTR) (Santa Cruz, sc108060, Dallas, TX, USA), a plasmid expressing a shRNA to inhibit ERRα gene (shERRα−/−) (Santa Cruz, sc44706-sh), according to the manufacturer’s protocol (Santa Cruz Biotecnology, https://www.scbt.com/it/resources/protocols/shrna-plasmid-dna-mediated-inhibition-of-gene-expression (accessed on 7 January 2020)), or ERRα cDNA expression plasmid(ERRα+/+) (ADGENE, #10975), according to X-tremeGENETM HP DNA Transfection Reagent Protocol (Sigma).

Techniques: Expressing, Phospho-proteomics

ERRα modulates H295R cell motility and Vimentin expression. ( a , b ) H295R (WT), H295R clones, knock in (ERRα+/+) or knock out (shERRα−/−) for ERRα gene, and H295R cell stably transfected with control plasmid (shCTR) were used in Wound Healing ( a ) and Boyden Chamber ( b ) assays as reported in “Materials and Methods”. Images are from a representative experiment. ( c , d ) H295R cells were treated with vehicle (0) or XCT790 (1, 5, 10 μM) for 18 h and Wound Healing ( c ) and Boyden Chamber ( d ) assays were performed as reported in “Materials and Methods”. Images are from a representative experiment. ( c ) The wounds were observed under an inverted microscope immediately (0 h) and 18 h after the scratch (100× magnification). ( b , d ) Migrated cells were photographed under an inverted microscope and counted (see Material and Methods), 20× magnification. Graphs represent the mean ± SD of three independent experiments. The number of untreated cells (0) was set as 100% (* p < 0.05 vs. 0). ( e ) Total proteins from H295R clones (shCTR, shERRα−/−, ERRα+/+) were analyzed by western Blotting (WB) using antibodies against ERRα and Vimentin. GAPDH was used as a loading control. Blots are representative of three independent experiments with similar results. ( f ) H295R were transfected for 48 h with pcDNA3.1 non containing (EV) or containing ERRα coding sequence (pcDNA3.1-ERRα). After transfection cells were left untreated (−) or treated (+) for 24 h with XCT790 (10 μM). Total proteins were analyzed by WB using antibodies against ERRα and Vimentin. GAPDH was used as a loading control. ( g ) Cells were untreated (0) or treated with XCT790 (1, 5, 10 μM) for 24 h. Total proteins were analyzed by WB using antibodies against ERRα and Vimentin. GAPDH was used as a loading control. Original image of western blot can be found at .

Journal: Cancers

Article Title: Estrogen Related Receptor Alpha (ERRα) a Bridge between Metabolism and Adrenocortical Cancer Progression

doi: 10.3390/cancers14163885

Figure Lengend Snippet: ERRα modulates H295R cell motility and Vimentin expression. ( a , b ) H295R (WT), H295R clones, knock in (ERRα+/+) or knock out (shERRα−/−) for ERRα gene, and H295R cell stably transfected with control plasmid (shCTR) were used in Wound Healing ( a ) and Boyden Chamber ( b ) assays as reported in “Materials and Methods”. Images are from a representative experiment. ( c , d ) H295R cells were treated with vehicle (0) or XCT790 (1, 5, 10 μM) for 18 h and Wound Healing ( c ) and Boyden Chamber ( d ) assays were performed as reported in “Materials and Methods”. Images are from a representative experiment. ( c ) The wounds were observed under an inverted microscope immediately (0 h) and 18 h after the scratch (100× magnification). ( b , d ) Migrated cells were photographed under an inverted microscope and counted (see Material and Methods), 20× magnification. Graphs represent the mean ± SD of three independent experiments. The number of untreated cells (0) was set as 100% (* p < 0.05 vs. 0). ( e ) Total proteins from H295R clones (shCTR, shERRα−/−, ERRα+/+) were analyzed by western Blotting (WB) using antibodies against ERRα and Vimentin. GAPDH was used as a loading control. Blots are representative of three independent experiments with similar results. ( f ) H295R were transfected for 48 h with pcDNA3.1 non containing (EV) or containing ERRα coding sequence (pcDNA3.1-ERRα). After transfection cells were left untreated (−) or treated (+) for 24 h with XCT790 (10 μM). Total proteins were analyzed by WB using antibodies against ERRα and Vimentin. GAPDH was used as a loading control. ( g ) Cells were untreated (0) or treated with XCT790 (1, 5, 10 μM) for 24 h. Total proteins were analyzed by WB using antibodies against ERRα and Vimentin. GAPDH was used as a loading control. Original image of western blot can be found at .

Article Snippet: After 48 h, cells were transfected with DNA plasmids: a plasmid encoding a scrambled short hairpin RNAs (shRNA) sequence (shCTR) (Santa Cruz, sc108060, Dallas, TX, USA), a plasmid expressing a shRNA to inhibit ERRα gene (shERRα−/−) (Santa Cruz, sc44706-sh), according to the manufacturer’s protocol (Santa Cruz Biotecnology, https://www.scbt.com/it/resources/protocols/shrna-plasmid-dna-mediated-inhibition-of-gene-expression (accessed on 7 January 2020)), or ERRα cDNA expression plasmid(ERRα+/+) (ADGENE, #10975), according to X-tremeGENETM HP DNA Transfection Reagent Protocol (Sigma).

Techniques: Expressing, Clone Assay, Knock-In, Knock-Out, Stable Transfection, Transfection, Control, Plasmid Preparation, Inverted Microscopy, Western Blot, Sequencing

ERRα promotes H295R spheroids formation. ( a ) H295R were transfected for 48 h with pcDNA3.1 non containing (EV) or containing ERRα coding sequence (pcDNA3.1-ERRα) and then grown as 3D spheroids for 5 days. Spheroids were counted under an inverted microscope and results were expressed as fold change over control (EV) ± SD (TSFE, tumor spheroids formation efficiency); (* p < 0.05 vs. EV). Insert confirms ERRα overexpression. ( b ) H295R cells were left untreated (0) or treated with XCT790 (1, 5, 10 μM) for 24 h and TSFE was evaluated 5 days later (* p < 0.05 vs. 0). Images below graph are from a representative experiment (20× magnification). ( c ) Wild type H295R (WT) and H295R clones (shCTR, shERRα−/−, ERRα+/+) were used to evaluate 3D spheroids formation. TSFE was evaluated 5 days later (* p < 0.05 vs. WT). Images below graph are from a representative experiment (20× magnification). ( d ) H295R spheroids (H295R Sph-5) were allowed to grow for 5 days and then trypsinized and reseeded weekly in spheroid media for 5 weeks. Boyden Chamber Assay was performed as reported in the “Materials and Methods”. Migrated cells were randomly photographed and counted with ImageJ software (* p < 0.05 vs. WT). ( e ) H295R (WT) cells and H295R grown as spheroids for 5 weeks (H295R Sph-5), were analyzed by WB using antibody against Vimentin. GAPDH was used as a loading control. Blots are representative of three independent experiments with similar results. Original image of western blot can be found at .

Journal: Cancers

Article Title: Estrogen Related Receptor Alpha (ERRα) a Bridge between Metabolism and Adrenocortical Cancer Progression

doi: 10.3390/cancers14163885

Figure Lengend Snippet: ERRα promotes H295R spheroids formation. ( a ) H295R were transfected for 48 h with pcDNA3.1 non containing (EV) or containing ERRα coding sequence (pcDNA3.1-ERRα) and then grown as 3D spheroids for 5 days. Spheroids were counted under an inverted microscope and results were expressed as fold change over control (EV) ± SD (TSFE, tumor spheroids formation efficiency); (* p < 0.05 vs. EV). Insert confirms ERRα overexpression. ( b ) H295R cells were left untreated (0) or treated with XCT790 (1, 5, 10 μM) for 24 h and TSFE was evaluated 5 days later (* p < 0.05 vs. 0). Images below graph are from a representative experiment (20× magnification). ( c ) Wild type H295R (WT) and H295R clones (shCTR, shERRα−/−, ERRα+/+) were used to evaluate 3D spheroids formation. TSFE was evaluated 5 days later (* p < 0.05 vs. WT). Images below graph are from a representative experiment (20× magnification). ( d ) H295R spheroids (H295R Sph-5) were allowed to grow for 5 days and then trypsinized and reseeded weekly in spheroid media for 5 weeks. Boyden Chamber Assay was performed as reported in the “Materials and Methods”. Migrated cells were randomly photographed and counted with ImageJ software (* p < 0.05 vs. WT). ( e ) H295R (WT) cells and H295R grown as spheroids for 5 weeks (H295R Sph-5), were analyzed by WB using antibody against Vimentin. GAPDH was used as a loading control. Blots are representative of three independent experiments with similar results. Original image of western blot can be found at .

Article Snippet: After 48 h, cells were transfected with DNA plasmids: a plasmid encoding a scrambled short hairpin RNAs (shRNA) sequence (shCTR) (Santa Cruz, sc108060, Dallas, TX, USA), a plasmid expressing a shRNA to inhibit ERRα gene (shERRα−/−) (Santa Cruz, sc44706-sh), according to the manufacturer’s protocol (Santa Cruz Biotecnology, https://www.scbt.com/it/resources/protocols/shrna-plasmid-dna-mediated-inhibition-of-gene-expression (accessed on 7 January 2020)), or ERRα cDNA expression plasmid(ERRα+/+) (ADGENE, #10975), according to X-tremeGENETM HP DNA Transfection Reagent Protocol (Sigma).

Techniques: Transfection, Sequencing, Inverted Microscopy, Control, Over Expression, Clone Assay, Boyden Chamber Assay, Software, Western Blot

ERRα expression levels and cholesterol influence H295R cell migration. ( a ) H295R clones (shCTR, ERRα+/+, shERRα−/−) were maintained in 5% FBS or 5% LpFS containing medium. Cells were used in Wound Healing ( a ) and Boyden Chamber ( b ) assays performed as reported in “Materials and Methods”. ( a ) Images are from a representative experiment (100× magnification). ( b ) Migrated cells were photographed under an inverted microscope (20× magnification) and counted with ImageJ software. Graphs represent the mean ± SD of three independent experiments (* p < 0.05 vs. FBS).

Journal: Cancers

Article Title: Estrogen Related Receptor Alpha (ERRα) a Bridge between Metabolism and Adrenocortical Cancer Progression

doi: 10.3390/cancers14163885

Figure Lengend Snippet: ERRα expression levels and cholesterol influence H295R cell migration. ( a ) H295R clones (shCTR, ERRα+/+, shERRα−/−) were maintained in 5% FBS or 5% LpFS containing medium. Cells were used in Wound Healing ( a ) and Boyden Chamber ( b ) assays performed as reported in “Materials and Methods”. ( a ) Images are from a representative experiment (100× magnification). ( b ) Migrated cells were photographed under an inverted microscope (20× magnification) and counted with ImageJ software. Graphs represent the mean ± SD of three independent experiments (* p < 0.05 vs. FBS).

Article Snippet: After 48 h, cells were transfected with DNA plasmids: a plasmid encoding a scrambled short hairpin RNAs (shRNA) sequence (shCTR) (Santa Cruz, sc108060, Dallas, TX, USA), a plasmid expressing a shRNA to inhibit ERRα gene (shERRα−/−) (Santa Cruz, sc44706-sh), according to the manufacturer’s protocol (Santa Cruz Biotecnology, https://www.scbt.com/it/resources/protocols/shrna-plasmid-dna-mediated-inhibition-of-gene-expression (accessed on 7 January 2020)), or ERRα cDNA expression plasmid(ERRα+/+) (ADGENE, #10975), according to X-tremeGENETM HP DNA Transfection Reagent Protocol (Sigma).

Techniques: Expressing, Migration, Clone Assay, Inverted Microscopy, Software